ID: 1097125778_1097125782

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1097125778 1097125782
Species Human (GRCh38) Human (GRCh38)
Location 12:56773845-56773867 12:56773858-56773880
Sequence CCCTCACTATGTGGCTCTACCTG GCTCTACCTGGCGGCCTTCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 151} {0: 1, 1: 0, 2: 1, 3: 8, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!