ID: 1097134599_1097134602

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1097134599 1097134602
Species Human (GRCh38) Human (GRCh38)
Location 12:56841219-56841241 12:56841233-56841255
Sequence CCACTACCAGCGCAGAAGGTAGT GAAGGTAGTACAGGCCCACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 69} {0: 1, 1: 0, 2: 2, 3: 8, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!