ID: 1097148351_1097148357

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1097148351 1097148357
Species Human (GRCh38) Human (GRCh38)
Location 12:56957406-56957428 12:56957442-56957464
Sequence CCGGTACCAGTGCAGAAGGTAGT AACCGCCAGGTAGAGCCACATGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 7, 4: 64} {0: 1, 1: 1, 2: 1, 3: 5, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!