ID: 1097293616_1097293623

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1097293616 1097293623
Species Human (GRCh38) Human (GRCh38)
Location 12:57941335-57941357 12:57941371-57941393
Sequence CCACACTGGGAGGGCAGCAGCGA CGGGTTGTTACAGCCTTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 207} {0: 1, 1: 0, 2: 1, 3: 3, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!