|
Left Crispr |
Right Crispr |
| Crispr ID |
1098500794 |
1098500797 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:71189318-71189340
|
12:71189332-71189354
|
| Sequence |
CCTAACATAAGGATTCACATAAA |
TCACATAAACTGAAGGTAAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 5, 2: 7, 3: 27, 4: 453} |
{0: 5, 1: 338, 2: 491, 3: 463, 4: 993} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|