ID: 1098556654_1098556660

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1098556654 1098556660
Species Human (GRCh38) Human (GRCh38)
Location 12:71825962-71825984 12:71826014-71826036
Sequence CCTGGGCGCCAGAGCAAGACTCC TCTGGAGAGGAAGGCTCCTGTGG
Strand - +
Off-target summary {0: 10, 1: 9789, 2: 57444, 3: 102493, 4: 138168} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!