ID: 1098556656_1098556660

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1098556656 1098556660
Species Human (GRCh38) Human (GRCh38)
Location 12:71825983-71826005 12:71826014-71826036
Sequence CCGTCTCAAAAAAAAAAAAATAA TCTGGAGAGGAAGGCTCCTGTGG
Strand - +
Off-target summary {0: 392, 1: 91386, 2: 74079, 3: 85580, 4: 120539} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!