ID: 1098711973_1098711976

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1098711973 1098711976
Species Human (GRCh38) Human (GRCh38)
Location 12:73774195-73774217 12:73774226-73774248
Sequence CCTTCACTCTTCTGGATGGGCAT AGGTCTCTTTCTTTATGGTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 18, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!