ID: 1098738066_1098738067

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1098738066 1098738067
Species Human (GRCh38) Human (GRCh38)
Location 12:74132737-74132759 12:74132755-74132777
Sequence CCATTTGTCAATTTTTGTTTTTG TTTTGTTGCATTTGCTTTTGAGG
Strand - +
Off-target summary {0: 277, 1: 2356, 2: 15287, 3: 12419, 4: 8900} {0: 303, 1: 1006, 2: 1658, 3: 2102, 4: 3193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!