ID: 1098738066_1098738068

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1098738066 1098738068
Species Human (GRCh38) Human (GRCh38)
Location 12:74132737-74132759 12:74132781-74132803
Sequence CCATTTGTCAATTTTTGTTTTTG TAGCCATAAATTCCTTCCTGAGG
Strand - +
Off-target summary {0: 277, 1: 2356, 2: 15287, 3: 12419, 4: 8900} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!