ID: 1098748633_1098748638

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1098748633 1098748638
Species Human (GRCh38) Human (GRCh38)
Location 12:74269029-74269051 12:74269046-74269068
Sequence CCAACCCTCCAAGTGCATGGAGC TGGAGCATTATATAAGGAAAAGG
Strand - +
Off-target summary No data {0: 10, 1: 14, 2: 10, 3: 35, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!