ID: 1098748633_1098748639

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1098748633 1098748639
Species Human (GRCh38) Human (GRCh38)
Location 12:74269029-74269051 12:74269047-74269069
Sequence CCAACCCTCCAAGTGCATGGAGC GGAGCATTATATAAGGAAAAGGG
Strand - +
Off-target summary No data {0: 9, 1: 18, 2: 24, 3: 76, 4: 613}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!