ID: 1098748633_1098748641

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1098748633 1098748641
Species Human (GRCh38) Human (GRCh38)
Location 12:74269029-74269051 12:74269063-74269085
Sequence CCAACCCTCCAAGTGCATGGAGC AAAAGGGCCTGTTAAACTCTGGG
Strand - +
Off-target summary No data {0: 11, 1: 10, 2: 42, 3: 53, 4: 873}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!