ID: 1099105057_1099105062

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1099105057 1099105062
Species Human (GRCh38) Human (GRCh38)
Location 12:78486637-78486659 12:78486661-78486683
Sequence CCATGAGGGACCTGCCTGTGTAG AAACTTGTGCCTGGGTATCCTGG
Strand - +
Off-target summary No data {0: 2, 1: 49, 2: 689, 3: 1357, 4: 1671}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!