ID: 1099184439_1099184446

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1099184439 1099184446
Species Human (GRCh38) Human (GRCh38)
Location 12:79502658-79502680 12:79502671-79502693
Sequence CCTCAAGAAGCTTCCAATCATGG CCAATCATGGAGGACGGGGAAGG
Strand - +
Off-target summary {0: 25, 1: 456, 2: 1652, 3: 8228, 4: 10079} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!