ID: 1099187836_1099187843

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1099187836 1099187843
Species Human (GRCh38) Human (GRCh38)
Location 12:79535095-79535117 12:79535143-79535165
Sequence CCAACATGGTGAAACCTCATCTC CCGTGGTGGCATGTGCCTGTAGG
Strand - +
Off-target summary {0: 3388, 1: 48596, 2: 103978, 3: 132260, 4: 102322} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!