ID: 1099187837_1099187843

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1099187837 1099187843
Species Human (GRCh38) Human (GRCh38)
Location 12:79535109-79535131 12:79535143-79535165
Sequence CCTCATCTCTCCTAAAAATACAA CCGTGGTGGCATGTGCCTGTAGG
Strand - +
Off-target summary {0: 468, 1: 85102, 2: 173521, 3: 172086, 4: 106503} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!