ID: 1099256963_1099256969

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1099256963 1099256969
Species Human (GRCh38) Human (GRCh38)
Location 12:80326098-80326120 12:80326122-80326144
Sequence CCTTATACCTGCAGTACTTGAGG AGGACTCAAATACTGAGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88} {0: 1, 1: 0, 2: 0, 3: 14, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!