ID: 1099558923_1099558929

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1099558923 1099558929
Species Human (GRCh38) Human (GRCh38)
Location 12:84148551-84148573 12:84148594-84148616
Sequence CCTGCTGCCCTGTGCAACCTTAG AGCCACTCCAGCTCCAGCTGTGG
Strand - +
Off-target summary No data {0: 59, 1: 89, 2: 214, 3: 429, 4: 862}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!