ID: 1099558923_1099558932

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1099558923 1099558932
Species Human (GRCh38) Human (GRCh38)
Location 12:84148551-84148573 12:84148602-84148624
Sequence CCTGCTGCCCTGTGCAACCTTAG CAGCTCCAGCTGTGGCTAAAAGG
Strand - +
Off-target summary No data {0: 144, 1: 312, 2: 656, 3: 1002, 4: 1494}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!