ID: 1099576944_1099576948

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1099576944 1099576948
Species Human (GRCh38) Human (GRCh38)
Location 12:84393807-84393829 12:84393827-84393849
Sequence CCACCTCTTTTTCAGGGTTTTCA TCAGGTCAAATTGGTCCCAATGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 29, 3: 114, 4: 403} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!