ID: 1099576944_1099576949

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1099576944 1099576949
Species Human (GRCh38) Human (GRCh38)
Location 12:84393807-84393829 12:84393833-84393855
Sequence CCACCTCTTTTTCAGGGTTTTCA CAAATTGGTCCCAATGGCTTAGG
Strand - +
Off-target summary No data {0: 112, 1: 96, 2: 39, 3: 17, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!