ID: 1099576944_1099576953

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1099576944 1099576953
Species Human (GRCh38) Human (GRCh38)
Location 12:84393807-84393829 12:84393847-84393869
Sequence CCACCTCTTTTTCAGGGTTTTCA TGGCTTAGGATGCATTTCAAGGG
Strand - +
Off-target summary No data {0: 152, 1: 61, 2: 27, 3: 20, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!