ID: 1099859641_1099859644

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1099859641 1099859644
Species Human (GRCh38) Human (GRCh38)
Location 12:88210501-88210523 12:88210516-88210538
Sequence CCCTTAGATCTGACATACAGAGA TACAGAGAAGAGTAATTACAGGG
Strand - +
Off-target summary {0: 45, 1: 35, 2: 21, 3: 35, 4: 180} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!