ID: 1099905121_1099905128

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1099905121 1099905128
Species Human (GRCh38) Human (GRCh38)
Location 12:88762000-88762022 12:88762039-88762061
Sequence CCTAGCAGAGACTCTCCATGAGG AAACTTCTGCCTGGAAATCCAGG
Strand - +
Off-target summary No data {0: 11, 1: 590, 2: 1540, 3: 1832, 4: 1714}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!