ID: 1099955734_1099955748

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1099955734 1099955748
Species Human (GRCh38) Human (GRCh38)
Location 12:89351580-89351602 12:89351610-89351632
Sequence CCCGCCCGCAGCCCTGCGCCCCT CCCCGCGCGCGGAGTTCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 77, 4: 646} {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!