ID: 1100331900_1100331906

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1100331900 1100331906
Species Human (GRCh38) Human (GRCh38)
Location 12:93590686-93590708 12:93590738-93590760
Sequence CCGGAGGCTGAGGCAGAAAGAAT GGCGCCACTGCACTCCAGCCTGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 54, 3: 478, 4: 3242} {0: 5047, 1: 62314, 2: 191429, 3: 242516, 4: 178772}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!