|
Left Crispr |
Right Crispr |
| Crispr ID |
1100486741 |
1100486749 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:95036592-95036614
|
12:95036632-95036654
|
| Sequence |
CCTCCGTCTCCTGGATTCAAGTG |
TCCTGCGTAGCTGGGATTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042} |
{0: 308, 1: 55896, 2: 144379, 3: 233479, 4: 202831} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|