|
Left Crispr |
Right Crispr |
| Crispr ID |
1100486742 |
1100486745 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:95036595-95036617
|
12:95036623-95036645
|
| Sequence |
CCGTCTCCTGGATTCAAGTGATT |
GCCTCAGCCTCCTGCGTAGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 79, 1: 2045, 2: 19892, 3: 49941, 4: 86213} |
{0: 489, 1: 88463, 2: 195329, 3: 232391, 4: 157110} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|