|
Left Crispr |
Right Crispr |
Crispr ID |
1100486743 |
1100486745 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:95036601-95036623
|
12:95036623-95036645
|
Sequence |
CCTGGATTCAAGTGATTCTCCTG |
GCCTCAGCCTCCTGCGTAGCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 2037, 1: 40996, 2: 111138, 3: 163941, 4: 210328} |
{0: 489, 1: 88463, 2: 195329, 3: 232391, 4: 157110} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|