ID: 1100612145_1100612150

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1100612145 1100612150
Species Human (GRCh38) Human (GRCh38)
Location 12:96200249-96200271 12:96200298-96200320
Sequence CCTGCAGTGCTATAGAACACGAG CTCTTAAGACTGATGAAGCTAGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 127, 3: 353, 4: 715} {0: 1, 1: 0, 2: 0, 3: 11, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!