ID: 1100618402_1100618412

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1100618402 1100618412
Species Human (GRCh38) Human (GRCh38)
Location 12:96249358-96249380 12:96249384-96249406
Sequence CCTGTGAGCTGGTGGTGACGCGC ACTGCGGAGGGGGAGGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49} {0: 1, 1: 0, 2: 2, 3: 30, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!