ID: 1100979077_1100979081

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1100979077 1100979081
Species Human (GRCh38) Human (GRCh38)
Location 12:100150654-100150676 12:100150705-100150727
Sequence CCTGAGTAGCAGGGATTACAGGC TTTTGTATTTTTAGTAGAGAAGG
Strand - +
Off-target summary {0: 378, 1: 74647, 2: 208210, 3: 229929, 4: 175092} {0: 194929, 1: 143151, 2: 66814, 3: 37831, 4: 46551}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!