ID: 1100979077_1100979081 |
View in Genome Browser |
Spacer: 28 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1100979077 | 1100979081 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 12:100150654-100150676 | 12:100150705-100150727 |
Sequence | CCTGAGTAGCAGGGATTACAGGC | TTTTGTATTTTTAGTAGAGAAGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |