ID: 1101377892_1101377895

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1101377892 1101377895
Species Human (GRCh38) Human (GRCh38)
Location 12:104186734-104186756 12:104186784-104186806
Sequence CCATTTCAAAAAAAAAAGAAAAG GTAGCTAGAAAGAATGAATCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!