ID: 1101427405_1101427416

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1101427405 1101427416
Species Human (GRCh38) Human (GRCh38)
Location 12:104599313-104599335 12:104599358-104599380
Sequence CCCCATAAAAGCAGACTTTTAAT CCGCGCGGTCCCGGAGCCATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 25, 4: 378} {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!