ID: 1101486194_1101486195

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1101486194 1101486195
Species Human (GRCh38) Human (GRCh38)
Location 12:105163509-105163531 12:105163525-105163547
Sequence CCTTTCTTTTTGAGGCAGGGTCT AGGGTCTTGCTCTGTCACCCAGG
Strand - +
Off-target summary {0: 2, 1: 25, 2: 221, 3: 693, 4: 1342} {0: 4209, 1: 20933, 2: 63781, 3: 122612, 4: 173503}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!