ID: 1101486194_1101486196

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1101486194 1101486196
Species Human (GRCh38) Human (GRCh38)
Location 12:105163509-105163531 12:105163529-105163551
Sequence CCTTTCTTTTTGAGGCAGGGTCT TCTTGCTCTGTCACCCAGGCTGG
Strand - +
Off-target summary {0: 2, 1: 25, 2: 221, 3: 693, 4: 1342} {0: 26457, 1: 73050, 2: 147182, 3: 159645, 4: 143243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!