ID: 1101486194_1101486197

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1101486194 1101486197
Species Human (GRCh38) Human (GRCh38)
Location 12:105163509-105163531 12:105163539-105163561
Sequence CCTTTCTTTTTGAGGCAGGGTCT TCACCCAGGCTGGAGTGCAGTGG
Strand - +
Off-target summary {0: 2, 1: 25, 2: 221, 3: 693, 4: 1342} {0: 81688, 1: 171766, 2: 204013, 3: 179579, 4: 118739}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!