|
Left Crispr |
Right Crispr |
| Crispr ID |
1101486194 |
1101486197 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:105163509-105163531
|
12:105163539-105163561
|
| Sequence |
CCTTTCTTTTTGAGGCAGGGTCT |
TCACCCAGGCTGGAGTGCAGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 25, 2: 221, 3: 693, 4: 1342} |
{0: 81688, 1: 171766, 2: 204013, 3: 179579, 4: 118739} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|