ID: 1101502664_1101502666

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1101502664 1101502666
Species Human (GRCh38) Human (GRCh38)
Location 12:105318832-105318854 12:105318850-105318872
Sequence CCAGGCATGGTGGCTCATGCCCG GCCCGCAATCCTGGCACTTTAGG
Strand - +
Off-target summary {0: 84, 1: 8789, 2: 40984, 3: 102915, 4: 176127} {0: 1, 1: 29, 2: 1652, 3: 26541, 4: 259529}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!