ID: 1101551395_1101551396

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1101551395 1101551396
Species Human (GRCh38) Human (GRCh38)
Location 12:105765657-105765679 12:105765693-105765715
Sequence CCTTAGACAAATTAAATTTAACA CAAAGAATGATTCGTGTATCAGG
Strand - +
Off-target summary {0: 35, 1: 91, 2: 86, 3: 108, 4: 548} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!