ID: 1101554066_1101554067

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1101554066 1101554067
Species Human (GRCh38) Human (GRCh38)
Location 12:105790709-105790731 12:105790725-105790747
Sequence CCATGGTGTCAACTGATCATCAC TCATCACCATGCACTCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 155} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!