ID: 1101569606_1101569610

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1101569606 1101569610
Species Human (GRCh38) Human (GRCh38)
Location 12:105941004-105941026 12:105941039-105941061
Sequence CCTCTCTGCTCTGCTTTGTGCTA AACAAGCTCCCTCCTTATGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!