ID: 1101612591_1101612598

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1101612591 1101612598
Species Human (GRCh38) Human (GRCh38)
Location 12:106304585-106304607 12:106304637-106304659
Sequence CCTCTGACTCCCTTCCCTTTACT TGACCTCGATCTAGTGTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 546} {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!