ID: 1101825889_1101825902

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1101825889 1101825902
Species Human (GRCh38) Human (GRCh38)
Location 12:108219711-108219733 12:108219757-108219779
Sequence CCACATTACAGGATAAGAGCTGG TACCCAGGACAACCCCAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 117} {0: 1, 1: 0, 2: 1, 3: 9, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!