ID: 1101878623_1101878631

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1101878623 1101878631
Species Human (GRCh38) Human (GRCh38)
Location 12:108611415-108611437 12:108611452-108611474
Sequence CCTGACCACCACCCACCAGATGC ACCAAACACGTCTCCAGACATGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 44, 3: 191, 4: 1129} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!