ID: 1101910476_1101910493

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1101910476 1101910493
Species Human (GRCh38) Human (GRCh38)
Location 12:108857368-108857390 12:108857419-108857441
Sequence CCGGCGGCCTCGGCGCGGCGTCC GGGGCTCACCTCGCTGTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 194} {0: 1, 1: 0, 2: 0, 3: 10, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!