ID: 1102185226_1102185230

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1102185226 1102185230
Species Human (GRCh38) Human (GRCh38)
Location 12:110942353-110942375 12:110942396-110942418
Sequence CCTAGGTATCTTCCTCAATAAAT TCTTGGTGTCTGCTTCCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 261} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!