ID: 1102818575_1102818586

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1102818575 1102818586
Species Human (GRCh38) Human (GRCh38)
Location 12:115888565-115888587 12:115888611-115888633
Sequence CCCCTGTATGTCCTTGGGTAACT TCTCCTCAGCTGTCTACCTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!