ID: 1102831568_1102831577

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1102831568 1102831577
Species Human (GRCh38) Human (GRCh38)
Location 12:116006604-116006626 12:116006650-116006672
Sequence CCACTTTCCCCTCAATCCTATGG TTATGCCTAAGCAGTACTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 244} {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!