ID: 1102950563_1102950570

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1102950563 1102950570
Species Human (GRCh38) Human (GRCh38)
Location 12:117028108-117028130 12:117028152-117028174
Sequence CCTGTGACGCCATGGCCACTCAC TTTCCCTATAACCATGTTTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92} {0: 1, 1: 0, 2: 1, 3: 14, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!